1-در حباب رونویسی حداكثر چند نوع نوكلئوتید وجود دارد ؟

1)4                 2)5                         3)6                           4)8

2-مولكول mRNA ای توسط یك ریبوزوم در حال ترجمه است ، پس از 5 بار حركت ریبوزوم روی این مولكول mRNA ، حداكثر چند پیوند پپتیدی بین آمینواسیدهای پپتید در حال ساخت  وجود دارد؟

1)6                     2)7                        3)5                          4)4

3-در كدامیك از حانداران زیر ، rRNA وtRNA  توسط یك نوع پلیمراز رونویسی می شود؟

1)تریكودینا                                              2)كاج

3)عامل مولد بیماری مالاریا در انسان        4) عامل مولد بیماری ذات الریه

4-اگر در یك مولكول mRNA در صد هریك از نوكلئوتیدها به صورت زیر  باشد، احتمال وجود یك رمز پایان در این مولكول چقدر است ؟          (A=25%,G=50%,C=12.5%,U=12.5% )

1)128/5                  2)128/1                   3)256/3                      4)256/1

5-با توجه به توالی mRNA مقابل ، در هنگام ترجمه چند رمز از جایگاه P و چند رمز از جایگاه A ریبوزوم عبور می كند؟

                          CUGAUGGCAAGUCCCAUUCGCACUUGAAUGUAAACC

1)7و7                     2)8و8                         3)9و10                        4)8و9

 

6-اگر وقوع جهش در DNA باعث تبدیل رمزATC به AAC شود، در هنگام ترجمه كدامیك از موارد زیر اتفاق می افتد؟

1)پروتئین طبیعی ساخته می شود.      2)پروتئین بلندتر از حد معمول ساخته می شود.

3)پروتئین ساخته نمی شود.                 4)پروتئین كوچكتر از حد معمول ساخته می شود.

7-اگر توالی بخشی از مولكول tRNA در حلقه آنتی كدون ACUGUAGAU باشد، توالی مولكول DNA ای كه الگوی این بخش بوده است، كدام است؟

1)ACTGTAGAT                                                         2)TGACATCTA

3)TCAGATGTA                                                         4)UGACAUCUA

8-در یك مولكول mRNA اولیه سه ناحیه اگزونی به طولهای  20 ، 30 و 40 نوكلئوتید حضور دارند. اگر طول اینترونها همگی یكسان و به طول 15 نوكلئوتید باشد، بخش رمز گردان ژن این مولكول mRNA دارای چند نوكلئوتید است؟

1)120                   2)135                   3)240                         4)270

9-مونومرهای فعال كننده ی توالی افزاینده  و مونومرهای مهار كننده اپراتور بترتیب توسط كدام  پیوند ها به هم متصل می شوند؟

1)پپتیدی  پپتیدی                                      2)پپتیدی  فسفودی استر

3)فسفو دی استر  پپتیدی                         4)فسفو دی استر  فسفودی استر

10-در هنگام ترجمه یك مولكول mRNA  زمانی كه tRNA  چهارم جایگاه P را ترك              می كند.........................

1)4 پیوند پپتیدی برقرار شده است.                              

2)4 آمینو اسید به tRNA  واقع در جایگاه A متصل است.

3)ضمن جابجائی ریبوزوم كدون 5 وارد جایگاه A می شود.

4)tRNA  پنجم وارد جایگاه A می شود.

11-در mRNA بالغ یوكاریوتی فقط قسمتی از رونوشت...............................

1)اگزونها حفظ می شود.                               2)اینترونها ترجمه نمی شود.

3)اگزونها ترجمه نمی شوند.                         4)اینترونها حذف می شوند.

12-تنوع محصول كدام RNA پلیمراز كمتر است؟

1)RNA  پلیمراز پروكاریوتی  2)RNA  پلیمراز 1      3)RNA  پلیمراز 2     4)RNA پلیمراز 3 

13-كدامیك از موارد زیر در یك سلول یافت می شود؟

1)توالی افزاینده  اپران                                  2)DNA  حلقوی  mRNA  چند ژنی

3)عامل رونویسی  اپران                               4)پلازمید  پروتئین فعال كننده

14- كدامیك از موارد زیر مختص سلولهای یوكاریوتی است؟

1)mRNA  تك ژنی           2)توالی اینترون        3)عوامل رونویسی     4)توالی اپراتور

15- در كدامیك از كروموزومهای انسان ، احتمال وقوع جهش بیشتر است؟

1)كروموزوم 21             2)كروموزوم 5           3)كروموزوم 1           4)كروموزوم X,Y

16- اگر در هنگام سنتز یك رشته پلی پپتید 49 مولكول آب آزاد شود منطقه ی رمز گردان مربوط به این رشته ی پلی پپتیددارای چند نوكلئوتید است:

1) 150                     2) 153                  3) 300                      4)306

17- چنانچه یك باز آدنین دار به ابتدای توالی زیر وارد شود چه تاثیری بر ترجمه خواهد گذاشت؟    

                                                                                                                                                                                                                                                           A

    CGA-UCG-GAA-CCA-GGU-GAU-AAG-CAU                                                                 

1)پروتئینی ساخته نخواهد شد.             2) طول پروتئین بیش از حد معمول خواهد شد.

 

3) طول پروتئین كمتر از حد معمول خواهد شد.       4) جهش بی تاثیر خواهد بود.

** با فرض اینكه رشته زیر مربوط به توالی بخشی از DNA باكتری اشریشیا كلی باشد به سوالات ۱۸و۱۹ پاسخ دهید:

TTCTACATGCGGAGCGAATGAACTAGC                                              

 

18- اگر از رشته مورد نظر رونویسی و ترجمه صورت گیرد آخرین كدونی كه در جایگاه P ریبوزوم قرار می گیرد كدامست؟

 

1) UGA                     2)ACU                  3)CUU                      4)AUG

19- با فرض اینكه از رشته مكمل فوق رونویسی و ترجمه صورت گیرد ریبوزوم چند بار بر روی mRNA   جابجا می شود؟

1)3                     2)4                       3)5                          4)6

20- ژن رمز گردان فعال كننده ی ژنی كه محصولش RNA ریبوزومی است توسط كدام رونویسی می شود؟

1) RNA پلیمراز 1      2) RNA پلیمراز 2      3) RNA پلیمراز 3      4) RNA  پلیمراز پروكاریوتی

نوشته شده در تاریخ یکشنبه 29 آذر 1388    | توسط: ماندانا شعبان    |    | نظرات()